The Journal of Bone & Joint Surgery

The Journal of Bone & Joint Surgery, Volume 94, Issue 11

Case Reports | June 06, 2012

A Novel Nonsense Mutation of the EXT1 Gene in an Argentinian Patient with Multiple Hereditary Exostoses: A Case Report

María Andrea Delgado, BS¹; Patricia Sarrión, BS³; Nydia Azar, MS¹; Lorena Zecchini, MD⁴; Hector Hugo Robledo, MD⁴; Florencio Segura, MD, PhD⁴; Susana Balcells, PhD³; Daniel Grinberg, PhD³; Raquel Dodelson de Kremer, MD, PhD¹; Carla Gabriela Asteggiano, PhD²

¹ Centro de Estudio de las Metabolopatías Congénitas (CEMECO), Hospital de Niños de la Santísima Trinidad, Ferroviarios 1250, CP: X5014AKN Córdoba, Argentina
³ Departament de Genética, Facultat de Biología, Universitat de Barcelona, Av. Diagonal 645, CP: 08028 Barcelona, Spain
⁴ Servicio de Traumatología (L.Z. and F.S.), Servicio de Bioimágenes (H.H.R.), Hospital de Niños de la Santísima Trinidad, Ferroviarios 1250, CP: X5014AKN Córdoba, Argentina
² Centro de Estudio de las Metabolopatías Congénitas (CEMECO), Universidad Nacional de Córdoba/Cátedra de Química Biológica, Facultad de Medicina, Universidad Católica de Córdoba, Ferroviarios 1250, CP: X5014AKN Córdoba, Argentina. E-mail address: asteggianocarla@hotmail.com

View Disclosures and Other Information

Disclosure statement for author(s): PDF

Investigation performed at Centro de Estudio de las Metabolopatías Congénitas, Facultad de Ciencias Médicas, Universidad Nacional de Córdoba, Hospital de Niños de la Santísima Trinidad, Córdoba, Argentina

Disclosure: One or more of the authors received payments or services, either directly or indirectly (i.e., via his or her institution), from a third party in support of an aspect of this work. None of the authors, or their institution(s), have had any financial relationship, in the thirty-six months prior to submission of this work, with any entity in the biomedical arena that could be perceived to influence or have the potential to influence what is written in this work. Also, no author has had any other relationships, or has engaged in any other activities, that could be perceived to influence or have the potential to influence what is written in this work. The complete Disclosures of Potential Conflicts of Interest submitted by authors are always provided with the online version of the article.

J Bone Joint Surg Am, 2012 Jun 06;94(11):e76 1-6. doi: 10.2106/JBJS.J.01920

5 Recommendations (Recommend) | 3 Comments | Saved by 3 Users Save Case

Article

Comments (0)

text A A A

Extract

Multiple hereditary exostoses (MHE), also known as multiple osteochondromatosis, is an autosomal-dominant O-linked glycosylation disorder recently classified as EXT1/EXT2-CDG in the congenital disorder of glycosylation (CDG) nomenclature¹. MHE is characterized by the presence of multiple cartilage-capped tumors, called “osteochondromas,” which usually develop in the juxta-epiphyseal regions of the long bones. The prevalence of MHE is estimated at 1:50,000 in the general population^2,3. The Online Mendelian Inheritance in Man (OMIM) database classified it as either 133700 or 133701, according to whether the mutations occurred in the EXT1 or the EXT2 gene. These genes are located at 8q24 and 11p11-11p12, respectively, and they encode the co-polymerases responsible for heparan sulfate biosynthesis. EXT1 and EXT2 are tumor suppressor genes of the EXT gene family. The EXT1 gene contains eleven exons with a coding region of 2238 base pairs (bp), and the EXT2 gene contains sixteen exons with a coding region of 2154 bp^4-7. These genes encode two glycosyltransferases involved in heparan sulfate biosynthesis, exostosin-1 (EXT1) (EC2.4.1.224) and exostosin-2 (EXT2) (EC2.4.1.225), whose impairment leads to the formation of exostoses^5,8-10. Inactivating mutations (nonsense, frameshift, and splice site mutations) in EXT1 and EXT2 genes represent the majority of mutations that cause MHE. An overview of the reported variants is provided by the online Multiple Osteochondroma Mutation Database¹¹.

Figures in this Article

Introduction

Introduction | Case Report | Discussion

The most important complication of MHE is the malignant transformation of osteochondroma to chondrosarcoma, which is estimated to occur in 0.5% to 5% of patients⁷. Chondrosarcomas arise de novo (primary) or as a result of a preexisting cartilage lesion (secondary). The biological aggressiveness of chondrosarcomas can be predicted by means of a histological grading system (grade I to grade III), based on three parameters: cellularity, degree of nuclear atypia, and mitotic activity^12,13.

In our case report, we investigated the clinical, radiographic, and genetic aspects of a patient with MHE with a severe phenotype and malignant transformation to chondrosarcoma. The patient was informed that data concerning her case would be submitted for publication, and she provided consent.

Case Report

Introduction | Case Report | Discussion

Our patient, a thirty-two-year-old woman with MHE, was first identified with this disorder when she was twenty-six years old in the Orthopedic and Imaging Diagnosis Department of Children’s Hospital of Cordoba, Argentina. She had developed a malignant transformation of a sessile osteochondroma in the left iliopubic region. She was included in the Argentinian Multiple Osteochondromatosis Program, which consisted of studies that had been approved by the Ethics Committee of the Children’s Hospital of Cordoba (CIEIS) Act No. 95/2007. The phenotypic data were based on clinical examinations and radiographic measurements and were analyzed according to variables representing lesion quality: count, morphology, and location. The quality of lesions was classified as: (a) type-I lesions (the size of the lesions correspond to ≤25% of native bone size); (b) type-II lesions (the size of the lesions correspond to 26% to 49% of native bone size); (c) type-III lesions (the size of the lesions correspond to 50% to 74% of native bone size); and (d) type-IV lesions (the size of the lesions correspond to ≥75% of native bone size)¹⁴. The severity of the disease was assessed with five factors: age of onset, number of exostoses, absence or presence of vertebral location, stature, and functional rating (good or fair). The degree of severity was represented in two groups, M (moderate) or S (severe). Group S was classified into four clinical subgroups according to the increasing grade of severity (type IS, type IIS, type IIIS, and type IVS), especially with regard to the lower percentile^14-16. In our patient, we defined the phenotype as severe (type IVS) based on the fair functional rating, the large number of exostoses (>25) and their vertebral locations, and very short stature (below the third percentile)¹⁵. In addition to the phenotype classification, clinical and radiographic variables were defined for the patient (Table I).

View Larger

TABLE I Clinical and Radiographic Features*

Variable	Clinical and Radiographic Findings
Lesion quality
No. of lesions	28 osteochondromas
Morphology
Type of lesions	Type I (≤25% of native bone size), 100%
	Simple lesions, 96.5% (n = 27)
	Complex lesions, 3.5% (n = 1)
Lesion characteristics
	Sessile osteochondromas, 86% (n = 24)
	Pedunculated osteochondromas, 14% (n = 4)
Location
	In pelvis, 17% (n = 5)
	In other bones, 83% (n = 23)
Age at onset (more or less than 3 years old)	>3 years old (12 years old)
Severity of the disease†
No. of exostoses (more or less than 10 osteochondromas)	>10 osteochondromas (n = 28)
Vertebral location of the exostoses (absence or presence)	Presence (9 mm × 5-mm osteochondroma on the fifth cervical vertebra, lateral)
Stature (more or less than 10th percentile)	<3rd percentile
Functional rating (good or fair)	Fair
Degree of severity	Group S (severe) (IVS) with secondary chondrosarcoma in pelvis

*Clinical classification of osteochondromas based on variables published by Boveé⁶.
†Evaluation of severity described in Francanet et al.¹⁴.

Add to My JBJS

TABLE I Clinical and Radiographic Features*

Variable	Clinical and Radiographic Findings
Lesion quality
No. of lesions	28 osteochondromas
Morphology
Type of lesions	Type I (≤25% of native bone size), 100%
	Simple lesions, 96.5% (n = 27)
	Complex lesions, 3.5% (n = 1)
Lesion characteristics
	Sessile osteochondromas, 86% (n = 24)
	Pedunculated osteochondromas, 14% (n = 4)
Location
	In pelvis, 17% (n = 5)
	In other bones, 83% (n = 23)
Age at onset (more or less than 3 years old)	>3 years old (12 years old)
Severity of the disease†
No. of exostoses (more or less than 10 osteochondromas)	>10 osteochondromas (n = 28)
Vertebral location of the exostoses (absence or presence)	Presence (9 mm × 5-mm osteochondroma on the fifth cervical vertebra, lateral)
Stature (more or less than 10th percentile)	<3rd percentile
Functional rating (good or fair)	Fair
Degree of severity	Group S (severe) (IVS) with secondary chondrosarcoma in pelvis

*Clinical classification of osteochondromas based on variables published by Boveé⁶.
†Evaluation of severity described in Francanet et al.¹⁴.

In our patient, multiple osteochondromas were detected by radiographs. A tibiofibular osteochondroma was observed on the proximal side of the right knee (Fig. 1-A). A large chondrosarcoma was detected on the left iliopubic bone (Fig. 1-B). In addition, there were left and right humeral osteochondromas, Madelung deformities in both radii (Fig. 1-C), and multiple tiny phalangeal osteochondromas. A pelvic magnetic resonance imaging (MRI) study demonstrated an iliac mass in the left iliopubic bone with a heterogeneous signal, with limb and pelvic compromise (Figs. 2-A and 2-B). The tissue had been resected with indistinct margins three times, but soon recurred. Clinically, the lesion behaved as a chondrosarcoma, and, in all three specimens obtained at the time of surgery, the histological findings demonstrated a low-grade neoplasia (grade-I chondrosarcoma).

Fig. 1

Radiographs demonstrating multiple osteochondromas at the tibia and fibula: next to the knee (Fig. 1-A), at the pelvis and proximal part of the femur (Fig. 1-B), and at the radius and ulna (Fig. 1-C).

View Large | Download Slide(.ppt)
Add to My JBJS

Fig. 2

Figs. 2-A and 2-B Our patient at age thirty-two. Fig. 2-A shows a chondrosarcoma in the pelvis and the proximal part of the femur. Fig. 2-B The coronal image of the pelvic MRI shows a large iliac mass on the left with a heterogeneous appearance, as well as shell and nodular calcifications growing into the inner pelvis, which produced lower-extremity compromise.

View Large | Download Slide(.ppt)
Add to My JBJS

Gross and microscopic evaluation of the pelvic tumor tissue showed a mesenchymal neoplasm with cartilaginous matrix production (Figs. 3-A and 3-B). Infiltration of cartilaginous islands in underlying bone tissue, with a profile of an expansive invasion, was also observed. Tissue that was excised during the first operation is shown in Figure 3-C. The family history revealed that the patient’s mother (fifty-three years old) and deceased grandfather both had a similar clinical presentation of MHE but without malignant transformation to chondrosarcoma (Fig. 4-A). The mother had the same clinical and imaging studies as the daughter, and the previously described variables also were analyzed.

Fig. 3

Figs. 3-A and 3-B Histologic findings (Fig. 3-A, hematoxylin and eosin stain, 100× magnification; Fig. 3-B, hematoxylin and eosin stain, 40× magnification) of the neoplasm excised from the chondrosarcoma showed a mesenchymal neoplasm with cartilaginous matrix production. The arrows point to nuclear enlargement and occasional binucleation of the atypical chondrocytes. Fig. 3-C A photograph of the resected tissue from the first incomplete excision.

View Large | Download Slide(.ppt)
Add to My JBJS

Fig. 4

Figs. 4-A and 4-B Pedigree of the family studied and mutation detection in the EXT1 gene. Fig. 4-A The patient is marked with an arrow, and other affected members are indicated by black squares or circles. Fig. 4-B Exon 1 partial sequence of the EXT1 gene. The arrow indicates the precise mutation in the patient (c.848T>A).

View Large | Download Slide(.ppt)
Add to My JBJS

We observed the same fair functional rating in the mother as in our patient, but, based on the absence of vertebral locations and her taller stature (below the 10th percentile), the degree of severity was classified as group IIS.

Genetic studies were performed for both our patient and her mother. The DNA taken from the patient’s blood and the tumor tissue was studied through direct mutational analysis with use of primer pairs to amplify the coding regions and the flanking intronic sequences of the EXT1 and EXT2 genes, modified from the methods of Wuyts et al.¹⁷ (Table II). Polymerase chain reaction products were sequenced on an ABI Prism DNA Analyzer 3700 or 3730 (Applied Biosystems), with use of BigDye Terminator chemistry (Applied Biosystems)¹⁷. Loss of heterozygosity was assessed in the tumor DNA¹⁸.

View Larger

TABLE II Polymerase Chain Reaction Primer Sequences Used for EXT1 and EXT2 Genes*

Primers	Reverse	Forward
EXT1 gene
Exon 1.1	5′tgggaaacttgggtgattctt 3′	3′gggatcaattggaaaacgaggattc 5′
Exon 1.2	5′ggcttgcagtttagggcatcgag 3′	3′ttgttccacaagtggagactcttg 5′
Exon 1.3	5′ccagttgtcacctcagtatgtgc 3′	3′aacttcacacctggaccaag 5′
Exon 2	5′ tgcgtaaattcatgcacatgg 3′	3′ggtttaacattatcacctctcc 5′
Exon 3	5′tgcgtaaattcatgcacatgg 3′	3′ttcactttccaacaaaatctcc 5′
Exon 4	5′ctatatgctagaagccaaatgc 3′	3′gattcctgtacttggatatattg 5′
Exon 5	5′tccattactctctctgtcttg 3′	3′gtccatctaacaccctgcat 5′
Exon 6	5′cctgtcaggacataagaagc 3′	3′gcctcgttacacccttttca 5′
Exon 7	5′tctgccgttttgtcttgctg 3′	3′gctttgtgaccttgtgtgtat 5′
Exon 8	5′gtgaggatgggagaattgtc 3′	3′gttttaatcagcccgattcct 5′
Exon 9	5′gaattaatgtttcgccacagtc 3′	3′ctgatgtgtcaaatgtgtgttt 5′
Exon 10	5′catcatcattatcattaccattc 3′	3′ccaaggatgtaaagctctcc 5′
Exon 11	5′ttgctgcttgctcatttgcc 3′	3′cttagatgagcagaatgacaaa 5′
EXT2 gene
Exon 4.1	5′tgagtgacagagtgaaaccc 3′	3′caaggtgtatatctatgctctg 5′
Exon 4.2	5′agccgacagtcccatccc 3′	3′cttctgctcttgagttggttt 5′
Exon 5	5′gttgggatttccaggagtttgc 3′	3′cctcctgaagatttagaagtg 5′
Exon 6	5′ccgagatgcgtgtataaggc 3′	3′gctgtctaccaagttttctaag 5′
Exon 7	5′tcaagaactgttcccaaataag 3′	3′ggtgtcttgtgttcgtgcaa 5′
Exon 8	5′agtattgcttggcgtcaacc 3′	3′gagagttagtacactggtcta 5′
Exon 9	5′aatggagctgtaagagaactc 3′	3′ggtttacttcctccactagat 5′
Exon 10	5′tggcttgaacagcagggag 3′	3′cctgataagggcagcataatt 5′
Exon 11	5′caccaagcctgccatgtttg 3′	3′catttctgagacagcatgcc 5′
Exon 12	5′acctttggatttgatgagagc 3′	3′gtgcgtaagagtgtgggtta 5′
Exon 13	5′tctccagaatcccattatgac 3′	3′cacgctcatagtagaaaatatg 5′
Exon 14	5′gtcacttgaccaaaagcattc 3′	3′ggactagataaactttaagctc 5′
Exon 15	5′cttgtgagttctgccgttgg 3′	3′gaatgctactcactcaatttgt 5′
Exon 16	5′acctgtcaacctttttaagaac 3′	3′gttgacctacttggatcttgg 5′

*This table was created based on the methods of Wuyts et al.¹⁷

Add to My JBJS

TABLE II Polymerase Chain Reaction Primer Sequences Used for EXT1 and EXT2 Genes*

Primers	Reverse	Forward
EXT1 gene
Exon 1.1	5′tgggaaacttgggtgattctt 3′	3′gggatcaattggaaaacgaggattc 5′
Exon 1.2	5′ggcttgcagtttagggcatcgag 3′	3′ttgttccacaagtggagactcttg 5′
Exon 1.3	5′ccagttgtcacctcagtatgtgc 3′	3′aacttcacacctggaccaag 5′
Exon 2	5′ tgcgtaaattcatgcacatgg 3′	3′ggtttaacattatcacctctcc 5′
Exon 3	5′tgcgtaaattcatgcacatgg 3′	3′ttcactttccaacaaaatctcc 5′
Exon 4	5′ctatatgctagaagccaaatgc 3′	3′gattcctgtacttggatatattg 5′
Exon 5	5′tccattactctctctgtcttg 3′	3′gtccatctaacaccctgcat 5′
Exon 6	5′cctgtcaggacataagaagc 3′	3′gcctcgttacacccttttca 5′
Exon 7	5′tctgccgttttgtcttgctg 3′	3′gctttgtgaccttgtgtgtat 5′
Exon 8	5′gtgaggatgggagaattgtc 3′	3′gttttaatcagcccgattcct 5′
Exon 9	5′gaattaatgtttcgccacagtc 3′	3′ctgatgtgtcaaatgtgtgttt 5′
Exon 10	5′catcatcattatcattaccattc 3′	3′ccaaggatgtaaagctctcc 5′
Exon 11	5′ttgctgcttgctcatttgcc 3′	3′cttagatgagcagaatgacaaa 5′
EXT2 gene
Exon 4.1	5′tgagtgacagagtgaaaccc 3′	3′caaggtgtatatctatgctctg 5′
Exon 4.2	5′agccgacagtcccatccc 3′	3′cttctgctcttgagttggttt 5′
Exon 5	5′gttgggatttccaggagtttgc 3′	3′cctcctgaagatttagaagtg 5′
Exon 6	5′ccgagatgcgtgtataaggc 3′	3′gctgtctaccaagttttctaag 5′
Exon 7	5′tcaagaactgttcccaaataag 3′	3′ggtgtcttgtgttcgtgcaa 5′
Exon 8	5′agtattgcttggcgtcaacc 3′	3′gagagttagtacactggtcta 5′
Exon 9	5′aatggagctgtaagagaactc 3′	3′ggtttacttcctccactagat 5′
Exon 10	5′tggcttgaacagcagggag 3′	3′cctgataagggcagcataatt 5′
Exon 11	5′caccaagcctgccatgtttg 3′	3′catttctgagacagcatgcc 5′
Exon 12	5′acctttggatttgatgagagc 3′	3′gtgcgtaagagtgtgggtta 5′
Exon 13	5′tctccagaatcccattatgac 3′	3′cacgctcatagtagaaaatatg 5′
Exon 14	5′gtcacttgaccaaaagcattc 3′	3′ggactagataaactttaagctc 5′
Exon 15	5′cttgtgagttctgccgttgg 3′	3′gaatgctactcactcaatttgt 5′
Exon 16	5′acctgtcaacctttttaagaac 3′	3′gttgacctacttggatcttgg 5′

*This table was created based on the methods of Wuyts et al.¹⁷

A novel heterozygous mutation in the genomic DNA of the patient was identified: a substitution in exon 1 of the EXT1 gene (c.848T>A) changed a leucine codon into a stop codon (p.L283X) in the EXT1 protein (Fig. 4-B). The patient was also heterozygous for the single nucleotide polymorphism rs11546829 in exon 3 of the EXT1 gene (Table III). Loss of heterozygosity was not observed in the analysis of DNA in the tumor tissue. The same heterozygous nonsense mutation in exon 1 (c.848T>A; p.L283X) was detected in the patient’s mother.

View Larger

TABLE III EXT1 Gene Changes Detected in Our Patient by Polymerase Chain Reaction and Direct Sequencing*

Gene	Exon/Intron	DNA Change	Protein Change	Ref SNP_ID†	Patient’s Genotype	MAF‡
EXT1	Exon 1	c.848T>A	p.L283X	---	T/A	---
EXT1	Exon 3	c.1035C>T	p.C355C	rs11546829	C/T	0.233
EXT1	Exon 9	c.1761G>A	p.E587E	rs7837891	A/A	0.367

*No changes were found in EXT2.
†Reference single nucleotide polymorphism.
‡Minor allele frequencies in a CEU population (dbSNP).

Add to My JBJS

TABLE III EXT1 Gene Changes Detected in Our Patient by Polymerase Chain Reaction and Direct Sequencing*

Gene	Exon/Intron	DNA Change	Protein Change	Ref SNP_ID†	Patient’s Genotype	MAF‡
EXT1	Exon 1	c.848T>A	p.L283X	---	T/A	---
EXT1	Exon 3	c.1035C>T	p.C355C	rs11546829	C/T	0.233
EXT1	Exon 9	c.1761G>A	p.E587E	rs7837891	A/A	0.367

*No changes were found in EXT2.
†Reference single nucleotide polymorphism.
‡Minor allele frequencies in a CEU population (dbSNP).

Discussion

Introduction | Case Report | Discussion

According to previous reports, the identification of novel and private mutations in a single family or patient support the strong allelic heterogeneity of EXT1 or EXT2 genes in patients with MHE¹⁹. To our knowledge, our case represents the first clinical and genetic report in the hereditary multiple osteochondromatosis program in Argentina and other Latin American countries, in collaboration with an interdisciplinary Spanish research group. The patient and her mother presented a heterozygous transversion in exon 1 (c.848T>A), resulting in a nonsense mutation (p.L283X) with loss of function in the amino-terminal region of the protein, which led to a prematurely truncated EXT1. The mutated protein only conserves 30.4% of the amino acids compared with the wild-type protein. Most patients with MHE present a wide spectrum of mutations in the EXT1 gene, most of which are null^11,15,17,19.

We observed differences in the grade of severity between the patient and her mother, similar to the intrafamilial variability reported previously in other families with MHE². This finding supports the variation in the expressivity of MHE that is in favor of genetic anticipation in this disease¹⁵.

It has been shown that hereditary osteochondromas and secondary chondrosarcomas are associated with a second mutational hit in the EXT1 gene^20,21. In our patient, we did not observe loss of heterozygosity as indicative of a somatic deletion in the DNA of the tumor. This situation rules out a complete deletion of the second EXT1 allele. A screening with a combined multiplex ligation-dependent probe amplification protocol could be performed to assess the presence of genetic rearrangements affecting other parts of the EXT1 gene²².

Although a basic molecular defect is known in most patients with MHE (a heterozygous mutation in either EXT1 or EXT2), the pathogenic mechanism is still unclear. Despite the fact that heparan sulfate proteoglycans have many roles in cell physiology and in different tissues, the loss of their specific function in chondrocytes and their deregulation in bone growth plate seem to be the principal cause of this pathology.

Jaeken J; Hennet T; Matthijs G; Freeze HH. CDG nomenclature: time for a change!Biochim Biophys Acta. 2009;1792:825-6.[CrossRef][PubMed]

Schmale GA; Conrad EU 3rd; Raskind WH. The natural history of hereditary multiple exostoses. J Bone Joint Surg Am. 1994;76:986-92.[PubMed]

Sandell LJ. Multiple hereditary exostosis, EXT genes, and skeletal development. J Bone Joint Surg Am. 2009 Jul;91 Suppl 4:58-62.[CrossRef][PubMed]

Ahn J; Lüdecke HJ; Lindow S; Horton WA; Lee B; Wagner MJ; Horsthemke B; Wells DE. Cloning of the putative tumour suppressor gene for hereditary multiple exostoses (EXT1). Nat Genet. 1995;11:137-43.[CrossRef][PubMed]

Stickens D; Clines G; Burbee D; Ramos P; Thomas S; Hogue D; Hecht JT; Lovett M; Evans GA. The EXT2 multiple exostoses gene defines a family of putative tumour suppressor genes. Nat Genet. 1996;14:25-32.[CrossRef][PubMed]

Lüdecke HJ; Ahn J; Lin X; Hill A; Wagner MJ; Schomburg L; Horsthemke B; Wells DE; Lüdecke HJ; Ahn J; Lin X; Hill A; Wagner MJ; Schomburg L; Horsthemke B; Wells DE. Genomics. 1997; 40:351-4.

Bovée JV. Multiple osteochondromas. Orphanet J Rare Dis. 2008;3:3.[CrossRef][PubMed]

McCormick C; Leduc Y; Martindale D; Mattison K; Esford LE; Dyer AP; Tufaro F. The putative tumour suppressor EXT1 alters the expression of cell-surface heparan sulfate. Nat Genet. 1998;19:158-61.[CrossRef][PubMed]

Lind T; Tufaro F; McCormick C; Lindahl U; Lidholt K. The putative tumor suppressors EXT1 and EXT2 are glycosyltransferases required for the biosynthesis of heparan sulfate. J Biol Chem. 1998;273:26265-8.[CrossRef][PubMed]

Simmons AD; Musy MM; Lopes CS; Hwang LY; Yang YP; Lovett M. A direct interaction between EXT proteins and glycosyltransferases is defective in hereditary multiple exostoses. Hum Mol Genet. 1999;8:2155-64.[CrossRef][PubMed]

Jennes I; Pedrini E; Zuntini M; Mordenti M; Balkassmi S; Asteggiano CG; Casey B; Bakker B; Sangiorgi L; Wuyts W. Multiple osteochondromas: mutation update and description of the multiple osteochondromas mutation database (MOdb). Hum Mutat. 2009;30:1620-7.[CrossRef][PubMed]

Hasegawa T; Seki K; Yang P; Hirose T; Hizawa K; Wada T; Wakabayashi J. Differentiation and proliferative activity in benign and malignant cartilage tumors of bone. Hum Pathol. 1995;26:838-45.[CrossRef][PubMed]

Kivioja A; Ervasti H; Kinnunen J; Kaitila I; Wolf M; Böhling T. Chondrosarcoma in a family with multiple hereditary exostoses. J Bone Joint Surg Br. 2000;82:261-6.[CrossRef][PubMed]

Alvarez C; Tredwell S; De Vera M; Hayden M. The genotype-phenotype correlation of hereditary multiple exostoses. Clin Genet. 2006;70:122-30.[CrossRef][PubMed]

Francannet C; Cohen-Tanugi A; Le Merrer M; Munnich A; Bonaventure J; Legeai-Mallet L. Genotype-phenotype correlation in hereditary multiple exostoses. J Med Genet. 2001;38:430-4.[CrossRef][PubMed]

Alvarez CM; De Vera MA; Heslip TR; Casey B. Evaluation of the anatomic burden of patients with hereditary multiple exostoses. Clin Orthop Relat Res. 2007;462:73-9.[CrossRef][PubMed]

Wuyts W; Van Hul W; De Boulle K; Hendrickx J; Bakker E; Vanhoenacker F; Mollica F; Lüdecke HJ; Sayli BS; Pazzaglia UE; Mortier G; Hamel B; Conrad EU; Matsushita M; Raskind WH; Willems PJ. Mutations in the EXT1 and EXT2 genes in hereditary multiple exostoses. Am J Hum Genet. 1998;62:346-54.[CrossRef][PubMed]

Raskind WH; Conrad EU; Chansky H; Matsushita M. Loss of heterozygosity in chondrosarcomas for markers linked to hereditary multiple exostoses loci on chromosomes 8 and 11. Am J Hum Genet. 1995;56:1132-9.[PubMed]

Pedrini E; De Luca A; Valente EM; Maini V; Capponcelli S; Mordenti M; Mingarelli R; Sangiorgi L; Dallapiccola B. Novel EXT1 and EXT2 mutations identified by DHPLC in Italian patients with multiple osteochondromas. Hum Mutat. 2005;26:280.[CrossRef][PubMed]

Bovée JV. EXTra hit for mouse osteochondroma. Proc Natl Acad Sci U S A. 2010;107:1813-4.[CrossRef][PubMed]

Hecht JT; Hogue D; Wang Y; Blanton SH; Wagner M; Strong LC; Raskind W; Hansen MF; Wells D. Hereditary multiple exostoses (EXT): mutational studies of familial EXT1 cases and EXT-associated malignancies. Am J Hum Genet. 1997;60:80-6.[PubMed]

White SJ; Vink GR; Kriek M; Wuyts W; Schouten J; Bakker B; Breuning MH; den Dunnen JT. Two-color multiplex ligation-dependent probe amplification: detecting genomic rearrangements in hereditary multiple exostoses. Hum Mutat. 2004;24:86-92.[CrossRef][PubMed]

Topics

hereditary multiple exostoses ; mutation, nonsense

First Page Preview

View Large

Username

Password

Access for Patients

Forgot Password?

Have a subscription to the print edition?

Not a Subscriber?

Buy this Article

Get online access for 30 days for $35

New to JBJS?

Subscribe to the online edition for 30 days for $75

Register for a FREE limited account to get full access to all CME activities, to comment on public articles, or to sign up for alerts.

Have a subscription to the print edition?

Current subscribers to The Journal of Bone & Joint Surgery in either the print or quarterly DVD formats receive free online access to JBJS.org.

Activate your online account now

Forgot your password?

Enter your username and email address. We'll send you a reminder to the email address on record.

Username:*

Email Address:*

Forgot your username or need assistance? Please contact customer service at subs@jbjs.org. If your access is provided
by your institution, please contact you librarian or administrator for username and password information. Institutional
administrators, to reset your institution's master username or password, please contact subs@jbjs.org

References

Accreditation Statement

These activities have been planned and implemented in accordance with the Essential Areas and policies of the Accreditation Council for Continuing Medical Education (ACCME) through the joint sponsorship of the American Academy of Orthopaedic Surgeons and The Journal of Bone and Joint Surgery, Inc. The American Academy of Orthopaedic Surgeons is accredited by the ACCME to provide continuing medical education for physicians.

CME Activities Associated with This Article

Submit a Comment

Please read the other comments before you post yours. Contributors must reveal any conflict of interest.
Comments are moderated and will appear on the site at the discretion of JBJS editorial staff.

* = Required Field

Comment Author(s) * (if multiple authors, separate names by comma)

Example: John Doe

Affiliation & Institution*

Disclosure

Comment Title*

Comment*

Cancel

Print
PDF
Email

Recipient(s) will receive an email with a link (good for 5 days) to 'A Novel Nonsense Mutation of the EXT1 Gene in an Argentinian Patient with Multiple Hereditary Exostoses: A Case Report'.
Your Name:*
Example: John Doe

Email Address:* CC Me:
Enter your valid email address. Example: jdoe@example.com

Recipient's Email Address:*

Separate multiple email address with semi-colons (up to 5).

Subject:* 's The Journal of Bone & Joint Surgery: 'A Novel Nonsense Mutation of the EXT1 Gene in an Argentinian Patient with Multiple Hereditary Exostoses: A Case Report'
Subject for your email.

Message:

(Optional, message will truncate at 1000 characters)

Processing your request... Please Wait...

Copyright © in the material you requested is held by The Journal of Bone & Joint Surgery, Inc. (unless otherwise noted). This email ability is provided as a courtesy, and by using it you agree that that you are requesting the material solely for personal, non-commercial use, and that it is subject to Journal of Bone & Joint Surgery, Inc.'s Terms of Use. The information provided in order to email this topic will not be used to send unsolicited email, nor will it be furnished to third parties. Please refer to The Journal of Bone & Joint Surgery Inc.'s Privacy Policy for further information.

Copyright © The Journal of Bone & Joint Surgery Inc. All rights reserved.
Share
Get Citation

María Andrea Delgado, Patricia Sarrión, Nydia Azar, Lorena Zecchini, Hector Hugo Robledo, Florencio Segura, Susana Balcells, Daniel Grinberg, Raquel Dodelson de Kremer, Carla Gabriela Asteggiano; A Novel Nonsense Mutation of the EXT1 Gene in an Argentinian Patient with Multiple Hereditary ExostosesA Case Report. The Journal of Bone & Joint Surgery. 2012 Jun;94(11):e76 1-6.

Download citation file:

RIS (Zotero)

EndNote

BibTex

Medlars

ProCite

RefWorks

Reference Manager

Copyright © The Journal of Bone and Joint Surgery, Inc.
Rights & Permissions
Article Alerts

Processing your request... Please Wait.
Submit a Comment