The Journal of Bone & Joint Surgery

The Journal of Bone & Joint Surgery, Volume 88, Issue suppl 3

Basic Science | November 01, 2006

Alcohol-Induced Adipogenesis in a Cloned Bone-Marrow Stem Cell

Quanjun Cui, MD; Yisheng Wang, MD; Khaled J. Saleh, MD, MSc, FRCSC; Gwo-Jaw Wang, MD; Gary Balian, PhD

Note: The authors wish to thank Dr. M. Daniel Lane (Johns Hopkins University, Baltimore, Maryland), who provided 422(aP2) cDNA (700 base pairs), and Dr. John Wozney (Genetics Institute, Cambridge, Massachusetts), who provided osteocalcin cDNA (500 base pairs).

The authors did not receive grants or outside funding in support of their research for or preparation of this manuscript. They did not receive payments or other benefits or a commitment or agreement to provide such benefits from a commercial entity. No commercial entity paid or directed, or agreed to pay or direct, any benefits to any research fund, foundation, educational institution, or other charitable or nonprofit organization with which the authors are affiliated or associated.

The Journal of Bone and Joint Surgery, Incorporated

J Bone Joint Surg Am, 2006 Nov 01;88(suppl 3):148-154. doi: 10.2106/JBJS.F.00534

5 Recommendations (Recommend) | 3 Comments | Saved by 3 Users Save Case

Article

Comments (0)

text A A A

Abstract

Background: Alcohol has been shown to be associated with osteoporosis and osteonecrosis in patients and in animal models. Recent studies have demonstrated that alcohol contributes to abnormal lipid metabolism in the stromal cells of bone marrow, but the mechanisms have not been defined. The purpose of this study was to evaluate the effects of alcohol on the differentiation of a stem cell that was cloned from bone marrow.

Methods: D1 cells (cloned bone-marrow stem cells from a BALB/c mouse) were treated either with increasing concentrations of ethanol (0.09, 0.15, and 0.21 mol/L) or without alcohol to serve as controls. Morphologic features of the cells were monitored with use of a phase-contrast microscope. Alkaline phosphatase activity was determined with use of a colorimetric assay. The expression of genes that are indicators of adipogenesis [422(aP2), PPAR?] and osteogenesis (osteocalcin) was evaluated using Northern blot and reverse transcription-polymerase chain reaction assays.

Results: The cells treated with ethanol started to accumulate triglyceride vesicles at day seven. The number of adipocytes and the percentage of the area that contained the cells with fat vesicles increased significantly (p < 0.05), and the level of alkaline phosphatase activity diminished with longer durations of exposure to ethanol and with higher concentrations. Analysis of gene expression showed diminished expression of osteocalcin. This occurred without a significant increase in the expression of either the fat-cell-specific gene 422(aP2) or PPAR? in cells treated with ethanol, suggesting that adipogenesis may occur at a point downstream in the fatty-acid-metabolism pathway.

Conclusions: Alcohol treatment decreases osteogenesis while enhancing adipogenesis in a cloned bone-marrow stem cell, indicating that alcohol abuse may be one of the mechanisms leading to osteoporosis and osteonecrosis. This finding explains the clinical observation that there is increased adipogenesis in alcohol-induced osteoporosis and osteonecrosis.

Clinical Relevance: The inhibition of bone-marrow adipogenesis and the concomitant enhancement of osteogenesis may provide a novel approach to the prevention or treatment of osteonecrosis and osteoporosis.

Figures in this Article

Nontraumatic osteonecrosis and osteoporosis have been proven to be associated with alcohol abuse in many published reports^1-11. Animals that have been treated with alcohol have shown fat-cell hypertrophy and proliferation in the subchondral area of the femoral head^12,13 and have also shown a marked rise in intraosseous pressure in the proximal aspect of the femur¹². It has been hypothesized that the increase in pressure and in fat-cell volume in the marrow eventually leads to collapse of the sinusoids in the femoral head as a result of intraosseous tamponade^3,14,15. When blood perfusion is diminished in the femoral head, osteonecrosis eventually develops^3,12,16-18. However, the mechanism of action of alcohol on cells in bone and in other organs with regard to its possible contribution to abnormal lipid metabolism has not been defined.

Recent studies on a bone-marrow stem cell, D1, which is cloned from bone-marrow stroma of a BALB/c mouse, showed that dexamethasone stimulated the differentiation of the cell into an adipocyte while inhibiting its osteogenic properties^19-21. D1 cells have been shown to produce a mineralized matrix and adipogenesis in vivo in diffusion chambers²². In addition to the production of mineral in the D1 cell cultures, the cell line also showed other osteogenic characteristics, including high alkaline phosphatase activity, the production of type-I collagen, increased production of cyclic adenosine monophosphate in response to treatment with parathyroid hormone, and expression of osteocalcin messenger ribonucleic acid (mRNA)²². These observations led us to hypothesize that alcohol also could stimulate the differentiation of D1 cells into adipocytes.

The main purpose of this study was to examine alcohol-induced changes in cell morphology and in gene expression by D1 cells during adipogenesis and osteogenesis and to determine the effect of alcohol on stem cells in bone marrow with regard to the contribution of alcohol to abnormal lipid metabolism associated with osteoporosis and osteonecrosis.

Materials and Methods

Materials and Methods | Results | Discussion | References

D1 cells (cloned bone-marrow stem cells from a BALB/c mouse²²) were maintained in culture^19,23 and treated with 0.09, 0.15, or 0.21 mol/L ethanol (Sigma-Aldrich, St. Louis, Missouri) daily for fourteen days as experimental groups. Cells that were not treated with ethanol served as control groups. Morphologic features of the cells were monitored with use of a phase-contrast microscope. For quantitative analysis of adipogenesis, cells were stained with Sudan IV (a stain for triglycerides in fat cells)²⁴ (Sigma-Aldrich) with the use of hematoxylin as a counterstain. An estimate of the number of adipocytes that stained with Sudan IV was made with use of image analysis software (Image-Pro Plus, version 4.1; Media Cybernetics, Silver Spring, Maryland). The average percentage of adipocyte areas in each culture dish was calculated. The mean of six dishes was taken as the value of the effect of each concentration of ethanol and was used as the basis for statistical analysis.

Messenger RNA was analyzed with use of Northern blot hybridization techniques as described in an earlier study¹⁹. Complementary DNA (cDNA) 422(aP2) (700 base pairs) and osteocalcin (500 base pairs) were used for hybridization. Through the use of previously described methods²³, a reverse transcription-polymerase chain reaction (RT-PCR) assay (RT-PCR kit; Ambion, Austin, Texas) was performed to determine the relative amounts of expression of osteocalcin and PPAR? mRNAs in the cells treated with and without ethanol. The following primer pairs were used: forward primer 5'GAGCAGAGCTCCCTGAACTG3' and reverse primer 5'GGTCGCCCTAGAGACAAG-AA3' for PCR amplification of the osteocalcin gene sequences, yielding a 200-bp product; and forward primer 5'CTGGCCTCCCTGATGAATAA3' and reverse primer 5'GGCGGTCTCCACTGAGAA-TA3' for PCR amplification of the PPAR? gene sequences, yielding a 205-bp product (primers were synthesized by the Biomolecular Research Facility, University of Virginia, Charlottesville, Virginia).

Alkaline phosphatase activity was determined with a colorimetric assay (Sigma-Aldrich). Confluent cells on days four, eight, and twelve were removed mechanically using 2 mL phosphate-buffered saline solution, sonicated at 20,000 Hz, and centrifuged at 700 × g for ten minutes in a Sorvall RMC 14 (Kendro, Newtown, Connecticut). The supernatants were used for the assay. Absorption was measured at 410 nm on a spectrophotometer (Spectronic Instruments, Rochester, New York) and compared with a p-nitrophenol standard curve. The values were standardized by determining the total DNA of the super-natants, which were measured with a spectrofluorimetric assay (Hoefer Pharmacia Biotech, San Francisco, California).

View Large | Download Slide(.ppt)
Add to My JBJS

Fig. 1: After fourteen days, cells in a culture stained with Sudan IV showed no triglyceride vesicles when treated without ethanol (A) and showed an accumulation of triglyceride vesicles when treated with 0.09 mol/L ethanol (B), 0.15 mol/L ethanol (C), and 0.21 mol/L ethanol (D) (original magnification, ×200).

Statistical analysis was performed to analyze the difference between the number of adipocytes and the level of alkaline phosphatase in culture at each time point and ethanol concentration, using an analysis of variance, followed by a Duncan multiple comparison procedure. Probability values of <0.05 were considered significant.

Results

Materials and Methods | Results | Discussion | References

Differentiation of D1 Cells into Adipocytes

When confluent monolayers of D1 cells were treated with increasing (0.09, 0.15, and 0.21 mol/L) concentrations of ethanol for seventy-two hours, the cells accumulated triglyceride vesicles, which were small initially and increased in size with time, as observed with use of phase-contrast microscopy. In contrast, cells that were not treated with ethanol did not show adipogenic changes. On day seven, the cells containing triglyceride vesicles clearly were distinguishable from the surrounding cells on phase-contrast microscopy and by staining with Sudan IV²⁴. After treatment with ethanol, the number of adipocytes in culture was dependent on the concentration of ethanol and on the duration of treatment; the highest frequency of fat cells occurred in cultures that were treated with 0.21 mol/L ethanol. Adipogenic changes were not found in the D1 cells that had not been treated with ethanol (Fig. 1). When cells were treated at the higher concentrations of ethanol, the area covered by adipocytes increased. In the cultures that were treated with 0, 0.09, 0.15, and 0.21 mol/L ethanol, the area covered by adipocytes was 0.01%, 21.4%, 39.1%, and 40.3%, respectively, at fourteen days. The percentage of the area that contained adipocytes in the cultures that were treated with ethanol increased significantly (p < 0.05) compared with the cultures that were not treated with ethanol.

Expression of Fat-Cell-Specific Genes

Total RNA analyzed by Northern blot hybridization with 422(aP2) cDNA showed that the expression of 422(aP2) mRNA in cells treated with 0.15 mol/L ethanol for fourteen days was not significantly changed compared with cells that were not treated with ethanol (Fig. 2). The results of RT-PCR showed that treatment with 0.09, 0.15, and 0.21 mol/L ethanol did not significantly change expression of PPAR? mRNA in the cells (Fig. 3).

Osteoblastic Gene Expression During Alcohol-Induced Adipogenic Differentiation

Beginning at day zero, D1 cells in culture were treated with or without 0.09, 0.15, and 0.21 mol/L ethanol for fourteen days. Northern blot hybridization with osteocalcin cDNA showed that treatment with 0.15 mol/L ethanol decreased expression of osteocalcin mRNA by 85% compared with the expression in control cells that were not treated with ethanol (Fig. 2). The results of RT-PCR showed that treatment with 0.09, 0.15, and 0.21 mol/L ethanol decreased expression of osteocalcin mRNA by 38%, 43%, and 54%, respectively, compared with control cells that were not treated with ethanol (Fig. 3).

Changes of Alkaline Phosphatase Activity During Alcohol-Induced Adipogenic Differentiation

In the D1 cells that were treated with ethanol at four, eight, and twelve days, the level of alkaline phosphatase activity was diminished with higher concentrations of ethanol and with longer durations of exposure to ethanol (Fig. 4). The cells that were not treated with ethanol expressed high levels of alkaline phosphatase activity that were 1.7, 2.8, and 13.9-fold higher than that in cells treated with 0.09, 0.15, and 0.21 mol/L ethanol, respectively, at twelve days (p < 0.001). The analysis, with use of analysis of variance, showed that the alkaline phosphatase activity decreased after treatment with the higher concentrations of ethanol (p < 0.01). The levels of alkaline phosphatase activity in cells that were not treated with ethanol increased with time (p < 0.01).

View Large | Download Slide(.ppt)
Add to My JBJS

Fig. 2: Northern blot hybridization for osteocalcin and 422(aP2) mRNA showed that treatment with 0.15 mol/L ethanol for fourteen days decreased expression of osteocalcin mRNA by 85% compared with cells that were not treated with ethanol. The expression of 422(aP2) mRNA in the cells treated with 0.15 mol/L ethanol was not significant.

View Large | Download Slide(.ppt)
Add to My JBJS

Fig. 3: Results of reverse transcription-polymerase chain reaction (RT-PCR) showed that treatment with 0.09, 0.15, and 0.21 mol/L ethanol for fourteen days decreased expression of osteocalcin mRNA (graph on left) and did not change expression of PPAR? mRNA (graph on right) in the D1 cells.

Discussion

Materials and Methods | Results | Discussion | References

The D1 cell that was cloned from mouse bone marrow is derived from a cell that is pluripotential and differentiates into progeny with osteogenic and adipogenic properties both in vitro and in vivo^19,20,22. These observations further confirmed the previous findings that there is a common precursor for several cell lines, including osteogenic, adipogenic, and chondrogenic lineages^19,22,25-29. Adipocyte-specific genes were cloned, and their promoter and/or enhancer regions have been explored. One of these genes, the adipocyte-specific fatty-acid-binding protein gene (aP2), has been well characterized, and its promoter has binding sites for each of the two major adipogenic transcription factors, C/EBPa (CCAAT/enhancer binding protein-a) and PPAR?^30,31. PPAR? is a member of the PPAR subfamily of nuclear hormone receptors and heterodimerizes with the retinoid X receptor a (RXRa) to promote gene expression. PPAR? is not expressed in preadipocytes (or is expressed at low levels) and is turned on during differentiation, a time that is prior to the expression of most adipocyte genes, many of which contain PPAR?-binding sites³⁰.

Corticosteroid-associated osteonecrosis and alcohol-associated osteonecrosis each constitute approximately one-third of the total cases of nontraumatic osteonecrosis. Recent observations of D1 cells treated with dexamethasone showed increased expression of a fat-cell-specific gene, 422(aP2), in vitro, indicating that dexamethasone is at least one of the factors required for these bone-marrow stem cells in culture to change from a primarily osteogenic nature to an adipogenic nature¹⁹. The glucocorticoids may control the processes of pluripotential cells differentiating into adipocytes. They also may stimulate the transdifferentiation of osteoblast-like cells into adipocytes^29,32. The actions of glucocorticoids on bone-marrow stem cells are complex and depend on the maturation stage and the species of the stem-cell population^33-35. The concentration of glucocorticoids and the length of exposure are important factors. Although physiologic concentrations of glucocorticoids appear to promote osteoblastic differentiation, treatment with supraphysiologic concentrations can enhance adipogenesis, leading to osteoporosis^16,19,33. The regulation of adipogenesis may involve complex mechanisms and interactions between multiple regulatory elements^{26,29,31,32,36,37}. However, the mechanism of action of alcohol on the cells and the contribution of alcohol to abnormal lipid metabolism has not been defined.

In the current study, D1 cells were maintained in standard culture medium as described previously^19,22. In the absence of ethanol, the pluripotential bone-marrow stem cell, D1, was osteogenic and differentiated mainly into osteoblasts. In the presence of ethanol, the differentiation into osteoblasts was decreased, whereas differentiation into adipocytes was greatly increased. The number and percentage of the culture area occupied by adipocytes increased with longer duration of exposure to and with higher concentrations of ethanol. The rapid appearance of triglyceride vesicles in the cells treated with ethanol suggests that this treatment had induced the differentiation of the cells into adipocytes. However, the treatment with ethanol did not change the expression of 422(aP2) and PPAR? mRNAs. Analysis of the results also shows diminished osteocalcin gene expression and alkaline phosphatase activity in the cells treated with ethanol, indicating decreased osteogenic properties. Inhibition of osteocalcin gene expression without an increase in 422(aP2) and PPAR? mRNAs suggests that adipogenesis (increased triglyceride vesicles) is caused by the action of ethanol downstream in the fatty-acid-metabolism pathway.

View Large | Download Slide(.ppt)
Add to My JBJS

Fig. 4: Graph showing changes in alkaline phosphatase activity in D1 cells that were treated with ethanol at four, eight, and twelve days. At twelve days, cells without ethanol treatment expressed alkaline phosphatase activity levels that were 1.7, 2.8, and 13.9-fold higher than those in cells treated with 0.09, 0.15, and 0.21 mol/L ethanol, respectively.

Multiple studies have indicated that alcoholism is present in 10% to 74% of patients with nontraumatic osteonecrosis of the femoral head^{1,3,4,6,8,11,12,38-40}. In separate epidemiologic works, Matsuo et al.⁵ and Hirota et al.² reported that individuals with alcoholism had an elevated risk ratio for the development of osteonecrosis of the femoral head. These findings suggest that there may be a cause-and-effect relationship between alcoholism and osteonecrosis. Ethanol is a cytotoxic factor that may play a key role in cell injury or death either directly or indirectly^9,41-43. Several hypotheses have been proposed^11,38,44-46. The influence of fat embolism^38,47,48, microfracture^49,50, intraosseous hypertension³³, vasculitis⁵¹, and intravascular coagulation^48,52 are some well-accepted theories. Fat-cell hypertrophy, an abnormal metabolism of fat^13,14, and an increase in intraosseous pressure in the proximal femur^10,12 have been demonstrated in animals treated with alcohol. The results of the current study indicate that fat-cell hypertrophy and proliferation in bone marrow may be a direct result of treatment with alcohol. These findings are relevant to numerous pathologic conditions. Alcohol can induce bone loss primarily as a result of reduced bone formation⁵³. An increase in fat volume in bone marrow and a decrease in hematopoietic cells and bone tissue have been reported in patients who have osteoporosis⁵⁴ and in a model of alcohol-induced osteonecrosis in animals¹³. Suh et al., in a recent study of thirty-three patients who underwent total hip replacement due to either femoral neck fracture or alcohol-associated osteonecrosis of the femoral head, demonstrated that the mesenchymal stem cells harvested from the osteonecrotic hips showed diminished osteogenic differentiation compared with cells collected from fractured hips⁵⁵. The current study on a cloned bone-marrow stem cell showed that treatment with alcohol diminished the osteogenic properties of the multipotent D1 cell while enhancing the adipogenic differentiation of the cell. These results support the findings of Suh et al. in their human subjects⁵⁵.

It is still not clear if adipogenesis directly causes osteonecrosis and osteoporosis. This study was not designed to address whether increased adipogenesis is a cause or effect of the mechanism involved in the human situation. However, recent studies in animals and in humans have demonstrated that lipid-lowering agents have therapeutic effects in the prevention and treatment of both osteoporosis and osteonecrosis^21,56,57, indicating that inhibition of adipogenesis by bone-marrow stem cells may be an alternative option for the treatment of the disease.

In summary, this study demonstrates that treatment with alcohol decreases osteogenesis while it enhances adipo-genesis in a cloned bone-marrow stem cell. The results indicate that alcohol can induce bone-marrow stem cells to produce fat. This finding explains the clinical observation that adipogenesis is increased in alcohol-induced osteonecrosis and osteoporosis. The clinical significance of the current study is that the inhibition of bone-marrow adipogenesis and the concomitant enhancement of osteogenesis may provide a novel approach to the prevention or treatment of osteonecrosis and osteoporosis. ?

References

Materials and Methods | Results | Discussion | References

Hungerford DS, Zizic TM. Alcoholism associated ischemic necrosis of the femoral head. Early diagnosis and treatment. Clin Orthop Relat Res. 1978;130: 144-53.130144 1978 [PubMed]

Hirota Y, Hirohata T, Fukuda K, Mori M, Yanagawa H, Ohno Y, Sugioka Y. Association of alcohol intake, cigarette smoking, and occupational status with the risk of idiopathic osteonecrosis of the femoral head. Am J Epidemiol. 1993;137: 530-8.137530 1993 [PubMed]

Hungerford DS, Lennox DW. The importance of increased intraosseous pressure in the development of osteonecrosis of the femoral head: implications for treatment. Orthop Clin North Am. 1985;16: 635-54.16635 1985 [PubMed]

Jacobs B. Epidemiology of traumatic and nontraumatic osteonecrosis. Clin Orthop Relat Res. 1978;130: 51-67.13051 1978 [PubMed]

Matsuo K, Hirohata T, Sugioka Y, Ikeda M, Fukuda A. Influence of alcohol in-take, cigarette smoking, and occupational status on idiopathic osteonecrosis of the femoral head. Clin Orthop Relat Res. 1988;234: 115-23.234115 1988

Mont MA, Hungerford DS. Non-traumatic avascular necrosis of the femoral head. J Bone Joint Surg Am. 1995;77: 459-74.77459 1995 [PubMed]

Chakkalakal DA. Alcohol-induced bone loss and deficient bone repair. Alcohol Clin Exp Res. 2005;29: 2077-90.292077 2005 [PubMed][CrossRef]

Gold EW, Cangemi PJ. Incidence and pathogenesis of alcohol-induced osteonecrosis of the femoral head. Clin Orthop Relat Res. 1979;143: 222-6.143222 1979

Hodges DL, Kumar VN, Redford JB. Effects of alcohol on bone, muscle and nerve. Am Fam Physician. 1986;34: 149-56.34149 1986 [PubMed]

Solomon L. Idiopathic necrosis of the femoral head: pathogenesis and treatment. Can J Surg. 1981;24: 573-8.24573 1981 [PubMed]

Arlet J. Nontraumatic avascular necrosis of the femoral head. Past, present, and future. Clin Orthop Relat Res. 1992;277: 12-21.27712 1992

Solomon L. Mechanisms of idiopathic osteonecrosis. Orthop Clin North Am. 1985;16: 655-67.16655 1985 [PubMed]

Wang Y, Li Y, Mao K, Li J, Cui Q, Wang GJ. Alcohol-induced adipogenesis in bone and marrow: a possible mechanism for osteonecrosis. Clin Orthop Relat Res. 2003;410: 213-24.410213 2003 [PubMed][CrossRef]

Wang GJ, Sweet DE, Reger SI, Thompson RC. Fat-cell changes as a mechanism of avascular necrosis of the femoral head in cortisone-treated rabbits. J Bone Joint Surg Am. 1977;59: 729-35.59729 1977 [PubMed]

Wang GJ, Lennox DW, Reger SI, Stamp WG, Hubbard SL. Cortisone-induced intrafemoral head pressure change and its response to a drilling decompression method. Clin Orthop Relat Res. 1981;159: 274-8.159274 1981

Wang GJ, Cui Q, Balian G. The pathogenesis and prevention of steroid-induced osteonecrosis. Clin Orthop Relat Res. 2000;370: 295-310.370295 2000 [CrossRef]

Wang GJ, Dughman SS, Reger SI, Stamp WG. The effect of core decompression on femoral head blood flow in steroid-induced avascular necrosis of the femoral head. J Bone Joint Surg Am. 1985;67: 121-4.67121 1985 [PubMed]

Lieberman JR, Berry DJ, Mont MA, Aaron RK, Callaghan JJ, Rajadhyaksha AD, Urbaniak JR. Osteonecrosis of the hip: management in the 21st century. Instr Course Lect. 2003;52: 337-55.52337 2003 [PubMed]

Cui Q, Wang GJ, Balian G. Steroid-induced adipogenesis in a pluripotential cell line from bone marrow. J Bone Joint Surg Am. 1997;79: 1054-63.791054 1997 [PubMed]

Cui Q, Wang GJ, Balian G. Pluripotential marrow cells produce adipocytes when transplanted into steroid-treated mice. Connect Tissue Res. 2000;41: 45-56.4145 2000 [PubMed][CrossRef]

Cui Q, Wang GJ, Su CC, Balian G. Lovastatin prevents steroid induced adipo-genesis and osteonecrosis. Clin Orthop Relat Res. 1997;344: 8-19.3448 1997 [PubMed]

Diduch DR, Coe MR, Joyner C, Owen ME, Balian G. Two cell lines from bone marrow that differ in terms of collagen synthesis, osteogenic characteristics, and matrix mineralization. J Bone Joint Surg Am. 1993;75: 92-105.7592 1993

Li X, Jin L, Cui Q, Wang GJ, Balian G. Steroid effects on osteogenesis through mesenchymal cell gene expression. Osteoporos Int. 2005;16: 101-8.16101 2005 [PubMed][CrossRef]

Gurr E. Synthetic dyes in biology, medicine and chemistry. London: Academic Press; 1971. 1971

Van Damme A, Vanden Driessche T, Collen D, Chuah MK. Bone marrow stromal cells as targets for gene therapy. Curr Gene Ther. 2002;2: 195-209.2195 2002 [PubMed][CrossRef]

Sekiya I, Larson BL, Vuoristo JT, Cui JG, Prockop DJ. Adipogenic differentiation of human adult stem cells from bone marrow stroma (MSCs). J Bone Miner Res. 2004;19: 256-64.19256 2004 [PubMed][CrossRef]

Lee HS, Huang GT, Chiang H, Chiou LL, Chen MH, Hsieh CH, Jiang CC. Multipotential mesenchymal stem cells from femoral bone marrow near the site of osteonecrosis. Stem Cells. 2003;21: 190-9.21190 2003 [PubMed][CrossRef]

Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, Benhaim P, Lorenz HP, Hedrick MH. Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng. 2001;7: 211-28.7211 2001 [CrossRef]

Beresford JN, Bennett JH, Devlin C, Leboy PS, Owen ME. Evidence for an inverse relationship between the differentiation of adipocytic and osteogenic cells in rat marrow stromal cell cultures. J Cell Sci. 1992;102: 341-51.102341 1992 [PubMed]

Lowell BB. PPARgamma: an essential regulator of adipogenesis and modulator of fat cell function. Cell. 1999;99: 239-42.99239 1999 [PubMed][CrossRef]

Tontonoz P, Hu E, Spiegelman BM. Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell. 1994;79: 1147-56. Erratum in: Cell. 1995;80:following 957.791147 1994 [PubMed][CrossRef]

Locklin RM, Williamson MC, Beresford JN, Triffitt JT, Owen ME. In vitro effects of growth factors and dexamethasone on rat marrow stromal cells. Clin Orthop Relat Res. 1995;313: 27-35.31327 1995 [PubMed]

Ishida Y, Heersche JN. Glucocorticoid-induced osteoporosis: both in vivo and in vitro concentrations of glucocorticoids higher than physiological levels attenuate osteoblast differentiation. J Bone Miner Res. 1998;13: 1822-6.131822 1998 [PubMed][CrossRef]

Jaiswal N, Haynesworth SE, Caplan AI, Bruder SP. Osteogenic differentiation of purified, culture-expanded human mesenchymal stem cells in vitro. J Cell Biochem. 1997;64: 295-312.64295 1997 [PubMed][CrossRef]

Chen TL, Cone CM, Feldman D. Glucocorticoid modulation of cell proliferation in cultured osteoblast-like bone cells: differences between rat and mouse. Endocrinology. 1983;112: 1739-45.1121739 1983 [PubMed][CrossRef]

Li X, Cui Q, Kao C, Wang GJ, Balian G. Lovastatin inhibits adipogenic and stimulates osteogenic differentiation by suppressing PPARgamma2 and increasing Cbfa1/Runx2 expression in bone marrow mesenchymal cell cultures. Bone. 2003;33: 652-9.33652 2003 [PubMed][CrossRef]

Pei L, Tontonoz P. Fat's loss is bone's gain. J Clin Invest. 2004;113: 805-6.113805 2004 [PubMed]

Jones JP Jr. Alcoholism, hypercortisonism, fat embolism and osseous avascular necrosis. 1971. Clin Orthop Relat Res. 2001;393: 4-12.3934 2001 [PubMed][CrossRef]

Solomon L. Drug-induced arthropathy and necrosis of the femoral head. J Bone Joint Surg Br. 1973;55: 246-61.55246 1973 [PubMed]

Jacobs B. Alcoholism-induced bone necrosis. NY State J Med. 1992;92: 334-8.92334 1992

Glimcher MJ, Kenzora JE. The biology of osteonecrosis of the human femoral head and its clinical implications: II. The pathological changes in the femoral head as an organ and in the hip joint. Clin Orthop Relat Res. 1979;139: 283-312.139283 1979 [PubMed]

Glimcher MJ, Kenzora JE. The biology of osteonecrosis of the human femoral head and its clinical implications: 1. Tissue biology. Clin Orthop Relat Res. 1979;138: 284-309.138284 1979 [PubMed]

Calder JD, Buttery L, Revell PA, Pearse M, Polak JM. Apoptosis—a significant cause of bone cell death in osteonecrosis of the femoral head. J Bone Joint Surg Br. 2004;86: 1209-13.861209 2004 [PubMed][CrossRef]

Jones LC, Hungerford DS. Osteonecrosis: etiology, diagnosis, and treatment. Curr Opin Rheumatol. 2004;16: 443-9.16443 2004 [PubMed][CrossRef]

Mankin HJ. Nontraumatic necrosis of bone (osteonecrosis). N Engl J Med. 1992;326: 1473-9.3261473 1992 [PubMed][CrossRef]

Steinberg ME. Osteonecrosis of the hip: summary and conclusions. Semin Arthroplasty. 1991;2: 241-9.2241 1991 [PubMed]

Jones JP Jr. Fat embolism and osteonecrosis. Orthop Clin North Am. 1985;16: 595-633.16595 1985 [PubMed]

Jones JP Jr. Intravascular coagulation and osteonecrosis. Clin Orthop Relat Res. 1992;277: 41-53.27741 1992 [PubMed]

Cruess RL. Osteonecrosis of bone. Current concepts as to etiology and pathogenesis. Clin Orthop Relat Res. 1986;208: 30-9.20830 1986

Cruess RL, Ross D, Crawshaw E. The etiology of steroid-induced avascular necrosis of bone. A laboratory and clinical study. Clin Orthop Relat Res. 1975;113: 178-83.113178 1975 [PubMed][CrossRef]

Matsui M, Saito S, Ohzono K, Sugano N, Saito M, Takaoka K, Ono K. Experimental steroid-induced osteonecrosis in adult rabbits with hypersensitivity vasculitis. Clin Orthop Relat Res. 1992;277: 61-72.27761 1992

Glueck CJ, Freiberg RA, Wang P. Role of thrombosis in osteonecrosis. Curr Hematol Rep. 2003;2: 417-22.2417 2003 [PubMed]

Turner RT, Evans GL, Zhang M, Sibonga JD. Effects of parathyroid hormone on bone formation in a rat model for chronic alcohol abuse. Alcohol Clin Exp Res. 2001;25: 667-71.25667 2001 [PubMed][CrossRef]

Meunier P, Aaron J, Edouard C, Vignon G. Osteoporosis and the replacement of cell populations of the marrow by adipose tissue. A quantitative study of 84 iliac bone biopsies. Clin Orthop Relat Res. 1971;80: 147-54.80147 1971 [CrossRef]

Suh KT, Kim SW, Roh HL, Youn MS, Jung JS. Decreased osteogenic differentiation of mesenchymal stem cells in alcohol-induced osteonecrosis. Clin Orthop Relat Res. 2005;431: 220-5.431220 2005 [PubMed][CrossRef]

Bowers JR, Dailiana ZH, McCarthy EF, Urbaniak JR. Drug therapy increases bone density in osteonecrosis of the femoral head in canines. J Surg Orthop Adv. 2004;13: 210-6.13210 2004 [PubMed]

Pritchett JW. Statin therapy decreases the risk of osteonecrosis in patients receiving steroids. Clin Orthop Relat Res. 2001;386: 173-8.386173 2001 [CrossRef]

Topics

ethanol ; obesity ; osteoporosis ; adipocytes ; alcohols ; hematopoietic stem cells ; bone marrow ; osteocalcin

Username

Password

Access for Patients

Forgot Password?

Have a subscription to the print edition?

Not a Subscriber?

Buy this Article

Get online access for 30 days for $35

New to JBJS?

Subscribe to the online edition for 30 days for $75

Register for a FREE limited account to get full access to all CME activities, to comment on public articles, or to sign up for alerts.

Have a subscription to the print edition?

Current subscribers to The Journal of Bone & Joint Surgery in either the print or quarterly DVD formats receive free online access to JBJS.org.

Activate your online account now

Forgot your password?

Enter your username and email address. We'll send you a reminder to the email address on record.

Username:*

Email Address:*

Forgot your username or need assistance? Please contact customer service at subs@jbjs.org. If your access is provided
by your institution, please contact you librarian or administrator for username and password information. Institutional
administrators, to reset your institution's master username or password, please contact subs@jbjs.org

References

Accreditation Statement

These activities have been planned and implemented in accordance with the Essential Areas and policies of the Accreditation Council for Continuing Medical Education (ACCME) through the joint sponsorship of the American Academy of Orthopaedic Surgeons and The Journal of Bone and Joint Surgery, Inc. The American Academy of Orthopaedic Surgeons is accredited by the ACCME to provide continuing medical education for physicians.

CME Activities Associated with This Article

Submit a Comment

Please read the other comments before you post yours. Contributors must reveal any conflict of interest.
Comments are moderated and will appear on the site at the discretion of JBJS editorial staff.

* = Required Field

Comment Author(s) * (if multiple authors, separate names by comma)

Example: John Doe

Affiliation & Institution*

Comment Title*

Comment*

Cancel

Print
Email

Recipient(s) will receive an email with a link (good for 5 days) to 'Alcohol-Induced Adipogenesis in a Cloned Bone-Marrow Stem Cell'.
Your Name:*
Example: John Doe

Email Address:* CC Me:
Enter your valid email address. Example: jdoe@example.com

Recipient's Email Address:*

Separate multiple email address with semi-colons (up to 5).

Subject:* 's The Journal of Bone & Joint Surgery: 'Alcohol-Induced Adipogenesis in a Cloned Bone-Marrow Stem Cell'
Subject for your email.

Message:

(Optional, message will truncate at 1000 characters)

Processing your request... Please Wait...

Copyright © in the material you requested is held by The Journal of Bone & Joint Surgery, Inc. (unless otherwise noted). This email ability is provided as a courtesy, and by using it you agree that that you are requesting the material solely for personal, non-commercial use, and that it is subject to Journal of Bone & Joint Surgery, Inc.'s Terms of Use. The information provided in order to email this topic will not be used to send unsolicited email, nor will it be furnished to third parties. Please refer to The Journal of Bone & Joint Surgery Inc.'s Privacy Policy for further information.

Copyright © The Journal of Bone & Joint Surgery Inc. All rights reserved.
Share
Get Citation

Quanjun Cui, Yisheng Wang, Khaled J. Saleh, Gwo-Jaw Wang, Gary Balian; Alcohol-Induced Adipogenesis in a Cloned Bone-Marrow Stem Cell. The Journal of Bone & Joint Surgery. 2006 Nov;88(suppl_3):148-154.

Download citation file:

RIS (Zotero)

EndNote

BibTex

Medlars

ProCite

RefWorks

Reference Manager

Copyright © The Journal of Bone and Joint Surgery, Inc.
Rights & Permissions
Article Alerts

Processing your request... Please Wait.
Submit a Comment